ID: 1129750836_1129750838

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1129750836 1129750838
Species Human (GRCh38) Human (GRCh38)
Location 15:78062333-78062355 15:78062371-78062393
Sequence CCAAACAACTTCAAAGTCACTAA TCACACCACTATAGCTTTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 194} {0: 1, 1: 0, 2: 2, 3: 4, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!