ID: 1129752765_1129752772

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1129752765 1129752772
Species Human (GRCh38) Human (GRCh38)
Location 15:78077498-78077520 15:78077543-78077565
Sequence CCACGCAGGGGGCCCTTGCCCGA AGCCGCGCTGGCTCCCGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 90} {0: 1, 1: 0, 2: 1, 3: 10, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!