ID: 1129761376_1129761388

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1129761376 1129761388
Species Human (GRCh38) Human (GRCh38)
Location 15:78131100-78131122 15:78131127-78131149
Sequence CCGAGAAAAGGGAGGGGCGGCGG GCGGGGCCTGTGTTGGGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 172} {0: 1, 1: 1, 2: 10, 3: 94, 4: 1032}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!