ID: 1129769619_1129769626

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1129769619 1129769626
Species Human (GRCh38) Human (GRCh38)
Location 15:78194692-78194714 15:78194712-78194734
Sequence CCGCCCATCGGCCCGAGTCGTCC TCCACAGCGCCTCCTCTGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 37} {0: 1, 1: 0, 2: 2, 3: 14, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!