ID: 1129775772_1129775778

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1129775772 1129775778
Species Human (GRCh38) Human (GRCh38)
Location 15:78235366-78235388 15:78235405-78235427
Sequence CCACGGCTCTGGAGGCCAGAAGT CGCAGGGCCACACTCCCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 45, 3: 138, 4: 442} {0: 1, 1: 2, 2: 8, 3: 37, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!