ID: 1129777767_1129777770

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1129777767 1129777770
Species Human (GRCh38) Human (GRCh38)
Location 15:78247955-78247977 15:78247977-78247999
Sequence CCAAGGGGAGATAGTGCAAAAGA AGAGGTGCAGCCCCTGCCTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 37, 4: 299}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!