ID: 1129780088_1129780093

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1129780088 1129780093
Species Human (GRCh38) Human (GRCh38)
Location 15:78264412-78264434 15:78264432-78264454
Sequence CCGGACGGGCGTCGGGGGTCTGG TGGGCCGCGAACCCGCCGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 90} {0: 1, 1: 0, 2: 0, 3: 4, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!