ID: 1129780183_1129780190

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1129780183 1129780190
Species Human (GRCh38) Human (GRCh38)
Location 15:78264746-78264768 15:78264775-78264797
Sequence CCCCCCCGCAGACACAAGATGGT GACCCAGTACTATGACATCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 78} {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!