ID: 1129780187_1129780196

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1129780187 1129780196
Species Human (GRCh38) Human (GRCh38)
Location 15:78264750-78264772 15:78264802-78264824
Sequence CCCGCAGACACAAGATGGTGAAG GAAGCCCAGCGCGTCCCCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 252} {0: 1, 1: 0, 2: 0, 3: 9, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!