ID: 1129810821_1129810828

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1129810821 1129810828
Species Human (GRCh38) Human (GRCh38)
Location 15:78508208-78508230 15:78508236-78508258
Sequence CCCTTGGGGTTGAACTGCCCCGT TGTGGAATGAAGGTCACCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 50} {0: 1, 1: 0, 2: 0, 3: 11, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!