ID: 1129827099_1129827106

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1129827099 1129827106
Species Human (GRCh38) Human (GRCh38)
Location 15:78641168-78641190 15:78641212-78641234
Sequence CCGCTGTGGGGTCACAGGGCACC AGCGCCGGTCCTGGCCCCCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 251} {0: 1, 1: 0, 2: 3, 3: 7, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!