ID: 1129832823_1129832829

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1129832823 1129832829
Species Human (GRCh38) Human (GRCh38)
Location 15:78681821-78681843 15:78681838-78681860
Sequence CCTGGCCATATGGCTCAGGGCCT GGGCCTCCCTGGGTGCACCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 188} {0: 1, 1: 0, 2: 2, 3: 19, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!