ID: 1129844764_1129844773

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1129844764 1129844773
Species Human (GRCh38) Human (GRCh38)
Location 15:78763185-78763207 15:78763236-78763258
Sequence CCCAGAGTCACTCAGCAGCCAGT TGACTCCAGGACCCAGCTCAGGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 4, 3: 60, 4: 606} {0: 2, 1: 2, 2: 3, 3: 37, 4: 369}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!