ID: 1129846505_1129846510

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1129846505 1129846510
Species Human (GRCh38) Human (GRCh38)
Location 15:78770354-78770376 15:78770371-78770393
Sequence CCCTGAGGATACTGAGTGTCAAC GTCAACAATGGGAAGACTGAGGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 6, 3: 28, 4: 166} {0: 1, 1: 3, 2: 1, 3: 20, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!