ID: 1129847158_1129847176

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1129847158 1129847176
Species Human (GRCh38) Human (GRCh38)
Location 15:78773228-78773250 15:78773276-78773298
Sequence CCCTGGTGCTGGCGGCCAGCCCT CAGAGTCAGGAGAAGAAAGCTGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 2, 3: 19, 4: 242} {0: 1, 1: 2, 2: 7, 3: 59, 4: 633}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!