|
Left Crispr |
Right Crispr |
| Crispr ID |
1129853046 |
1129853051 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:78805782-78805804
|
15:78805828-78805850
|
| Sequence |
CCTTCAAATGGAGAAATGGCCAG |
CGCAGCATTTTGGAAGACCGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 1, 3: 11, 4: 184} |
{0: 1, 1: 4, 2: 549, 3: 13955, 4: 162953} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|