ID: 1129854146_1129854153

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1129854146 1129854153
Species Human (GRCh38) Human (GRCh38)
Location 15:78811863-78811885 15:78811893-78811915
Sequence CCGGGGGCCCTGCTTCAAAGCTA AGACAGGCCTGGGCCCTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 148} {0: 1, 1: 1, 2: 2, 3: 47, 4: 438}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!