ID: 1129854147_1129854155

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1129854147 1129854155
Species Human (GRCh38) Human (GRCh38)
Location 15:78811870-78811892 15:78811904-78811926
Sequence CCCTGCTTCAAAGCTATCTGCGG GGCCCTCCCTGGACAGACAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 95} {0: 1, 1: 0, 2: 2, 3: 39, 4: 320}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!