ID: 1129857120_1129857131

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1129857120 1129857131
Species Human (GRCh38) Human (GRCh38)
Location 15:78832305-78832327 15:78832344-78832366
Sequence CCCATCTCCTCTGGCTTCAGTTT TGGGGATGAGATGAATCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 435} {0: 1, 1: 0, 2: 3, 3: 16, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!