ID: 1129868287_1129868302

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1129868287 1129868302
Species Human (GRCh38) Human (GRCh38)
Location 15:78925253-78925275 15:78925298-78925320
Sequence CCAAGTCCCACGAGTGGGGTGTG CCACTGTCCCTCCTGGCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 80} {0: 1, 1: 1, 2: 6, 3: 55, 4: 450}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!