ID: 1129889866_1129889868

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1129889866 1129889868
Species Human (GRCh38) Human (GRCh38)
Location 15:79064929-79064951 15:79064949-79064971
Sequence CCTTCTAGGTCCTGGGGTTAGAG GAGCGATGAGTAAACAGACACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 18, 4: 200} {0: 1, 1: 0, 2: 1, 3: 11, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!