ID: 1129890446_1129890452

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1129890446 1129890452
Species Human (GRCh38) Human (GRCh38)
Location 15:79068233-79068255 15:79068273-79068295
Sequence CCAGGGTCCTTCTGTTCACGCTG AATGGAGAAGAGTTAATAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 193} {0: 1, 1: 0, 2: 4, 3: 18, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!