ID: 1129930200_1129930209

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1129930200 1129930209
Species Human (GRCh38) Human (GRCh38)
Location 15:79404246-79404268 15:79404276-79404298
Sequence CCTATTGTAATCATCCTGCCACC TGGTTGGTCTTCTTAAGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 146} {0: 1, 1: 0, 2: 1, 3: 17, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!