ID: 1129981166_1129981172

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1129981166 1129981172
Species Human (GRCh38) Human (GRCh38)
Location 15:79872589-79872611 15:79872616-79872638
Sequence CCCACATTTGGCTATATGTAAAT GGGCAGGTCAATGCAAATTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 246} {0: 4, 1: 11, 2: 20, 3: 46, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!