ID: 1129986418_1129986422

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1129986418 1129986422
Species Human (GRCh38) Human (GRCh38)
Location 15:79923299-79923321 15:79923312-79923334
Sequence CCAAGGGGAAGCCCCGAGGGGAC CCGAGGGGACCCCGCGCCGTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 158} {0: 1, 1: 0, 2: 0, 3: 5, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!