ID: 1130040230_1130040239

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1130040230 1130040239
Species Human (GRCh38) Human (GRCh38)
Location 15:80400323-80400345 15:80400375-80400397
Sequence CCACATTTGATCTGTTATAAGTC ATAGAGAAGAAGGCAGGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 161} {0: 1, 1: 0, 2: 3, 3: 83, 4: 792}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!