ID: 1130040901_1130040913

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1130040901 1130040913
Species Human (GRCh38) Human (GRCh38)
Location 15:80404543-80404565 15:80404579-80404601
Sequence CCGGGTGAGTAGCGGCCTGGGCC CAGCCCGCAGGCCTTGCCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 219} {0: 1, 1: 0, 2: 1, 3: 23, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!