ID: 1130040903_1130040913

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1130040903 1130040913
Species Human (GRCh38) Human (GRCh38)
Location 15:80404564-80404586 15:80404579-80404601
Sequence CCCCGCCGCCCGCCGCAGCCCGC CAGCCCGCAGGCCTTGCCCGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 139, 4: 936} {0: 1, 1: 0, 2: 1, 3: 23, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!