ID: 1130046988_1130046991

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1130046988 1130046991
Species Human (GRCh38) Human (GRCh38)
Location 15:80453275-80453297 15:80453292-80453314
Sequence CCAGGGGCAAGGGCAGGACCTGT ACCTGTGGAAGGCAAATCAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 35, 4: 358} {0: 1, 1: 0, 2: 4, 3: 39, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!