ID: 1130053590_1130053601

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1130053590 1130053601
Species Human (GRCh38) Human (GRCh38)
Location 15:80504062-80504084 15:80504101-80504123
Sequence CCTCTCTTGCATGTATTTTCACT CATTTGGAGCAGTGGGACGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 269} {0: 1, 1: 0, 2: 0, 3: 11, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!