ID: 1130060736_1130060741

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1130060736 1130060741
Species Human (GRCh38) Human (GRCh38)
Location 15:80568088-80568110 15:80568131-80568153
Sequence CCACTACAAAGAAGACCTCTTTA GTTCCATCAAATATGGAATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 160} {0: 1, 1: 0, 2: 0, 3: 8, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!