ID: 1130065284_1130065289

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1130065284 1130065289
Species Human (GRCh38) Human (GRCh38)
Location 15:80597623-80597645 15:80597647-80597669
Sequence CCTTGAAAGTGGCAAAATGGAGG TTCACAGGCTGTGCGGGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 209} {0: 1, 1: 0, 2: 1, 3: 15, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!