ID: 1130065867_1130065870

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1130065867 1130065870
Species Human (GRCh38) Human (GRCh38)
Location 15:80604551-80604573 15:80604594-80604616
Sequence CCAGGAAGGGCTGAGTATCTCAT TTAAGCAAGAGGTCCCAGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 120} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!