ID: 1130080429_1130080437

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1130080429 1130080437
Species Human (GRCh38) Human (GRCh38)
Location 15:80728065-80728087 15:80728113-80728135
Sequence CCTGGCAGGAACCTTAGTTTCCT CCACCTTGTAAACTGTTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 169} {0: 1, 1: 0, 2: 0, 3: 15, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!