|
Left Crispr |
Right Crispr |
| Crispr ID |
1130092667 |
1130092678 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:80834054-80834076
|
15:80834105-80834127
|
| Sequence |
CCTTGGCCTTCATCCACTAGGTG |
TCCCAAAATGTCTCCAGACATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 25, 3: 170, 4: 734} |
{0: 1, 1: 4, 2: 29, 3: 83, 4: 296} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|