ID: 1130099123_1130099127

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1130099123 1130099127
Species Human (GRCh38) Human (GRCh38)
Location 15:80878767-80878789 15:80878780-80878802
Sequence CCCTGGCCATGACCAAGACCACC CAAGACCACCATGTGCATATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 231} {0: 1, 1: 0, 2: 1, 3: 9, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!