ID: 1130115529_1130115546

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1130115529 1130115546
Species Human (GRCh38) Human (GRCh38)
Location 15:81001850-81001872 15:81001885-81001907
Sequence CCCGTCCCGCCCTCCCCGCTCCG GGCCATGCCCAAGAAGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 72, 4: 693} {0: 1, 1: 0, 2: 1, 3: 13, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!