ID: 1130127587_1130127594

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1130127587 1130127594
Species Human (GRCh38) Human (GRCh38)
Location 15:81106779-81106801 15:81106813-81106835
Sequence CCAGTGTGGCTGTGTGGTGGCTC CCCAGGACTTTGGGAGGCCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 216} {0: 964, 1: 121705, 2: 270466, 3: 214392, 4: 127352}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!