ID: 1130129838_1130129840

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1130129838 1130129840
Species Human (GRCh38) Human (GRCh38)
Location 15:81130891-81130913 15:81130918-81130940
Sequence CCTAACATTTATTGATTGGATTT TCTTATATGCCCATGGTTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 385} {0: 1, 1: 0, 2: 26, 3: 101, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!