ID: 1130153590_1130153596

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1130153590 1130153596
Species Human (GRCh38) Human (GRCh38)
Location 15:81331161-81331183 15:81331183-81331205
Sequence CCTGGATAAAGAAAGCAGCCACC CTTTTAAGCAGTCGGTGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 11, 2: 4, 3: 19, 4: 201} {0: 1, 1: 5, 2: 4, 3: 11, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!