ID: 1130154876_1130154886

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1130154876 1130154886
Species Human (GRCh38) Human (GRCh38)
Location 15:81341651-81341673 15:81341690-81341712
Sequence CCCTGAAGTCCCGAGACCACAAC ATAAGACAAGTCACTGAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 79} {0: 1, 1: 0, 2: 0, 3: 16, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!