ID: 1130154877_1130154885

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1130154877 1130154885
Species Human (GRCh38) Human (GRCh38)
Location 15:81341652-81341674 15:81341687-81341709
Sequence CCTGAAGTCCCGAGACCACAACC AAGATAAGACAAGTCACTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 101} {0: 1, 1: 0, 2: 1, 3: 23, 4: 333}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!