ID: 1130162322_1130162332

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1130162322 1130162332
Species Human (GRCh38) Human (GRCh38)
Location 15:81414003-81414025 15:81414034-81414056
Sequence CCGGAGCCGGCTGCCTCTGCTGG TGCGGAGGCAGAAGCGTGGGCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!