ID: 1130179931_1130179936

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1130179931 1130179936
Species Human (GRCh38) Human (GRCh38)
Location 15:81615414-81615436 15:81615464-81615486
Sequence CCAGTTTGGGGTTCTTATAGATA TGTCCTTTTATTAAAGAGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 38, 4: 621}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!