ID: 1130211808_1130211814 |
View in Genome Browser |
Spacer: 22 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1130211808 | 1130211814 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 15:81930834-81930856 | 15:81930879-81930901 |
| Sequence | CCGCTGCACCCAACCAAGTCTAC | CACTGCCAGTGAACTGCACGTGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 2, 2: 14, 3: 162, 4: 1244} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||