ID: 1130245610_1130245618

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1130245610 1130245618
Species Human (GRCh38) Human (GRCh38)
Location 15:82245598-82245620 15:82245643-82245665
Sequence CCTGCCACAAGGAGAGGTGAAGG GTCAAAACTGAGATGGGGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 233} {0: 2, 1: 0, 2: 2, 3: 21, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!