ID: 1130268785_1130268790

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1130268785 1130268790
Species Human (GRCh38) Human (GRCh38)
Location 15:82432615-82432637 15:82432630-82432652
Sequence CCCTGCAGGATCTGGAGGTAAGA AGGTAAGAGGCCCTGGGCCGAGG
Strand - +
Off-target summary {0: 2, 1: 22, 2: 20, 3: 22, 4: 177} {0: 9, 1: 8, 2: 22, 3: 27, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!