ID: 1130280908_1130280919

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1130280908 1130280919
Species Human (GRCh38) Human (GRCh38)
Location 15:82519879-82519901 15:82519921-82519943
Sequence CCTAGTCAGTCAGCCCCACCCCT CTGCCCTTGCCAATCACCCCAGG
Strand - +
Off-target summary {0: 8, 1: 0, 2: 0, 3: 22, 4: 273} {0: 9, 1: 1, 2: 23, 3: 28, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!