ID: 1130298663_1130298667

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1130298663 1130298667
Species Human (GRCh38) Human (GRCh38)
Location 15:82664382-82664404 15:82664396-82664418
Sequence CCTTTCTCCTCATCCTCATCCTG CTCATCCTGGTCTTCATTGTCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 18, 3: 223, 4: 1907} {0: 1, 1: 0, 2: 3, 3: 17, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!