ID: 1130298663_1130298669

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1130298663 1130298669
Species Human (GRCh38) Human (GRCh38)
Location 15:82664382-82664404 15:82664408-82664430
Sequence CCTTTCTCCTCATCCTCATCCTG TTCATTGTCGGACTCACTGCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 18, 3: 223, 4: 1907} {0: 1, 1: 0, 2: 0, 3: 2, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!